Skip to main content

PhiX Control Library Index Sequences

PhiX Control Library, Adept

The PhiX Control Library, Adept index sequences for Version 1 and Cloudbreak sequencing chemistries are the reverse complement of each other. See the following tables.

Index Sequences for Version 1 Chemistry

Sample NameIndex 1 SequenceIndex 2 Sequence
Adept_CB1CTAGCGACATTACGAGCTAG
Adept_CB2ACGATCTGTGAGACTCTCGT
Adept_CB3GACTATGTGCGCTAGTAGTC
Adept_CB4TGTCGACACACTGTCAGACA

Index Sequences for Cloudbreak Chemistry

Sample NameIndex 1 SequenceIndex 2 Sequence
Adept_CB1ATGTCGCTAGCTAGCTCGTA
Adept_CB2CACAGATCGTACGAGAGTCT
Adept_CB3GCACATAGTCGACTACTAGC
Adept_CB4TGTGTCGACATGTCTGACAG

PhiX Control Library, Elevate

Sample NameIndex 1 SequenceIndex 2 Sequence
Elevate_CB1GCTACACGTTGCACTAGC
Elevate_CB2CAGCATGTGACAGTGTCT
Elevate_CB3ATCGTGTACCTGTACGAG
Elevate_CB4TGATGCACAGATCGACTA

Cloudbreak PhiX Control Library, Elevate

Sample NameIndex 1 SequenceIndex 2 Sequence
CBPhiXA1ACGTGTAGCGCTAGTGCA
CBPhiXB2CACATGCTGAGACACTGT
CBPhiXC3GTACACGATCTCGTACAG
CBPhiXD4TGTGCATCATAGTCGATC