Custom Designer
ElemBio Cloud Custom Designer™ allows you to create custom workflows for Teton™ and Teton Atlas™ chemistries on the AVITI24™ System. Teton supports advanced cellular profiling, gene expression, and cell morphology analysis. Teton Atlas builds upon this foundation with highly multiplexed, modular co-detection of cell morphology, gene expression, and protein expression that uses Direct In Sample Sequencing (DISS) chemistry.
Custom Designer supports the following designs:
- Teton Add-On Protein Panel: Design custom protein content for a Teton Protein add-on that is compatible with Teton fixed panel runs. Custom protein content includes up to 88-plex custom proteins, or a combination of 24-plex Teton focus panels and 24 custom proteins for up to 72 targets.
- Teton Atlas Custom Workflow: Design modular Teton Atlas custom workflows through the customization of dynamic cell paint (morphology), protein, and RNA analysis modules.
Custom designs that are created on ElemBio Cloud are available on connected AVITI24 Systems.
Don't have an ElemBio Cloud account yet? Request access to Custom Designer.
Add a custom design
Design a Teton add-on protein panel
- On the Custom Designer page, select Start a Design.
- Select Design a Teton Add-On Protein Panel.
- Enter a unique name.
- (Optional) Provide a description.
- Select Next.
- Select a protein add-on type:
- Full Custom Protein Panel: Enter up to 88 protein target names and make sure that the protein names are formatted correctly.
- Teton Focus Panels + Optional Custom Protein: Select a combination of at least one Teton Focus Panel (24 protein targets each) and up to 24 custom proteins for a total of at most 72 targets.
To prevent barcode collision, only one Teton Focus Panel per set is permitted.
- Select Next.
- Review and confirm your design summary.
- Select Save as Draft or Publish Design.
Only published designs can be used in a planned or manual run on the instrument.
Design a Teton Atlas custom workflow
- On the Custom Designer page, select Start a Design.
- Select Design a Teton Atlas Custom Workflow.
- Enter a unique name.
- (Optional) Provide a description.
- Select Next.
- Select the Cell Paint module, and then select your cell paint type:
- 3-Plex: Species Agnostic: Includes cell membrane, nucleus, and actin.
- 6-Plex: Human Only: (Coming soon) Includes cell membrane, nucleus, actin, endoplasmic reticulum, golgi apparatus, and mitochondria.
- Select the Protein Module, and then select a protein add-on type:
- Full Custom Protein Panel: Enter up to 88 protein target names and make sure that the protein names are formatted correctly.
- Teton Focus Panels + Optional Custom Protein: Select a combination of at least one Teton Focus Panel (24 protein targets each) and up to 24 custom proteins for a total of at most 72 targets.
To prevent barcode collision, only one Teton Focus Panel per set is permitted.
- Select the RNA Sequencing module, and then select an RNA application type. For more information on how to configure RNA inputs, see Customize an RNA sequencing batch.
- Guide RNA Sequencing Applications: Use for optical pooled screens, spacers, barcodes, and similar.
- Advanced Non-Guide RNA Sequencing Applications: Use for advanced applications that require custom primers such as sequencing viral transcripts or gene fusions.
- Select Next.
RT and sequencing primers are generated and all uploaded target cell assignment manifests are validated against the customized RNA application.
- Review and confirm your design summary.
- Select Save as Draft or Publish Design.
Only published designs can be used in a planned run or manual run on the instrument.
- (Optional) To request an order quote for your custom design, select Request a Quote.
- To order RT and sequencing primers, download the design package and provide the
primer_sequences.csvfile to any oligo manufacturer. For more information, see Order RT and Sequencing Primers.
Customize an RNA sequencing batch
DISS chemistry on Teton Atlas is supported by single‑sided probe chemistry for cDNA extension, circularization, and rolling‑circle amplification, which is followed by sequencing that uses Avidite™ base chemistry (ABC). A dual-primer design is used to improve specificity for guide RNA sequencing.
Direct In Sample Sequencing
In this scheme, a reverse transcription (RT) primer binds to the 3′ flanking region of the target RNA sequence (for example, downstream of the target region, and toward the 3′ end of the RNA). Reverse transcription proceeds toward the 5' end of the RNA, and synthesizes cDNA that contains the intended target sequence. After cDNA circularization and rolling circle amplification completes, a sequencing primer binds upstream of the target. Sequencing immediately starts at the end of the sequencing primer and proceeds in the 3' to 5' direction relative to the parent RNA. This orientation ensures that the RT primer and the sequencing primer bind successfully at opposite ends of the target. This dual-binding requirement increases specificity and helps prevent off-target reads.
Guide-based primer scheme
Based on your needs, select one of the following RNA applications:
- Guide RNA Sequencing Applications: ElemBio Cloud designs the RT and sequencing primer for you.
- Input 80-100 base pairs of the target's downstream sequence and Custom Designer generates complimentary RT and sequencing primers for your target of interest.
- Order primers from any third-party oligo provider.
- Complete target-to-cell assignment for optical pooled screens that use spacers, barcodes, or similar where perterbations are assigned to cells.
- Advanced Non-Guide RNA Sequencing Applications: Design your own primers for advanced applications such as sequencing viral transcripts, gene fusions, and more.
- When designed, you can upload sequences as part of your custom design.
- For more information on criteria and support for custom primer designs, see the Teton Atlas Custom Primer Design Tech Note.
When you use Custom Designer for non-guide RNA sequencing applications, you assume the risk of run failures and detrimental run peformance. For more information on optimization of primers for non-guide RNA applications, contact Element Technical Support to discuss your use case.
Set up guide RNA sequencing applications
For guide RNA sequencing applications, you can define up to 5 target sites. The settings you configure here — particularly Target Site Name, Cycle Length, and TargetMask — must align with the spacer sequences you provide in your target cell assignment manifest. For each target site, complete the following fields:
-
Select the RNA Sequencing module, and then select
Guide RNA Sequencing Applications. -
In the Cycle Length field, enter 4-36 sequencing cycles, and up to 100 cycles for advanced applications.
The maximum cycle length for guide RNA sequencing applications is 36, and 100 for advanced applications. Set the cycle length to equal your spacer sequence length. For example, if your spacers are 20 bp, enter 20.
-
Enter a unique name for the target site.
This name must match the
TargetSiteNamevalues in your target cell assignment manifest exactly, including capitalization. A mismatch causes the manifest to fail validation. -
In the Downstream Flanking Sequence field, use bases A, T, C, and G to enter 80-100 base pairs from the region downstream of your target site.
Enter this sequence in the 5' to 3' direction. This is the 100 bp immediately downstream of your guide RNA spacer region on the sense strand of your construct. Custom Designer uses this sequence to generate RT and sequencing primer designs.
-
In the Perform Target Cell Assignment field, select Yes or No based on the following:
- Yes: Onboard target to cell assignment occurs and additional output files are generated. Also, selecting Yes requires a target cell assignment manifest during run setup. Select Yes for spacers, barcodes, or similar.
- No: Onboard target to cell assignment does not occur.
-
If you selected Yes to perform target cell assignment, enter a basemask in the
TargetMaskfield that defines the cycles in which your target is present.TargetMasklength cannot exceed 36 base pairs.This value is validated against all target cell assignment manifests that are attached to the design, and must match the sequence length of target sequences that are defined in the target.
How to set your
TargetMask:- Use
Yfollowed by a number to include cycles (e.g.,Y20) andN*to skip remaining cycles. - For a 20 bp spacer starting at cycle 1, enter
Y20N*. - For a 23 bp spacer starting at cycle 1, enter
Y23N*. - The number of
Ycycles must equal the length of spacer sequences in your manifest.
For the full base mask specification, see Base masks.
- Use
-
In the Set up target cell manifests section, if you have selected Yes to perform target cell assignment, then set up target cell assignment manifests. For more information, see Prepare a target cell assignment manifest. For guidance on how the system uses the manifest to assign cells to spacers after the run, see Cell assignment logic.
-
(Optional) To add another target site, select Add Another Target Site and repeat steps 1-7. You can add up to 5 target sites.
The TargetMask you enter here is stored in the design's panel.json. When you upload a target cell assignment manifest to this design, the manifest is validated against this mask — spacer sequence lengths must match the number of Y cycles. If they do not match, the manifest upload fails. You can also override the TargetMask per-manifest using the [TARGET SITE SETTINGS] section. For more information, see Target site settings.
Set up advanced non-guide RNA sequencing applications
-
Select the RNA Sequencing module, select
Advanced Non-Guide RNA Sequencing Applications. -
In the Cycle Length field, enter up to 100 cycles for advanced applications.
-
Select the checkbox to acknowledge risks.
-
Upload a csv file of your custom primers. For more information on criteria and support for custom primer designs, see the Teton Atlas Custom Primer Design Tech Note. The following is an example
.csvformat:TargetSiteName, TargetMask, RTOligo, SequencingPrimer1_FirstTarget,Y20N*, GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTAAGCTTGGCGTAACTAGA, ATTTTAACTTGCTATTTCTAGCTCTAAAAC2_SecondTarget,Y20N*,GTTTCAGAGCTAAGCACAAGAGTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTTACAACTTGAAAAAGTGGCACCCGAGTCGGGTGC,CACTTTTTCAAGTTGTAAACGGACTAGCCT
Order custom primers for RNA sequencing
- On the Custom Designer page, locate the published custom design that you want to order primers from.
- Select the three dots (...) under the Actions column, and then select Download Package.
- Locate the downloaded package in your OS.
- Unzip the downloaded package, and then identify the
primer-sequences.csvfile. - To order desalted, single-pool primers, provide the
primer-sequences.csvfile to any oligo manufacturer.
Format custom protein targets
Custom protein targets that are part of custom designs must meet the following specifications:
- Protein names can include up to 64 letters (A-Z, a-z), numbers (0-9), dash, dot, parentheses, and underscores. Do not include spaces.
- Protein names must be unique. To increase the counts per cell of a single protein target, append a suffix such as _1, _2 to the target name, e.g., RAF1_1, RAF1_2.
- For manual entry, separate protein names with a new line, paste from Excel, or upload the protein names in a CSV file format.
- Protein names cannot contain the reserved terms diversity, decoy, or start with nsb, case-insensitive.
The following list are examples of custom protein target names:
phos-ATM
Plk1
phosS32-cFos
phosS78-HSP27
Rb
cFOS
JNK123
Edit a custom design
You can edit a custom design that is in Draft status or add a target cell assignment manifest to a published design.
- On the Custom Designer page, locate and select the design that you want to edit.
- Update your custom design as needed.
- On the Design Summary page, select Save as Draft or Publish Design.
Only published designs can be used in a planned run or manual run on the instrument.
View or download a custom design
To reference a saved custom design, you can view the design or download the design package for a published design.
- On the Custom Designer page, locate the custom design that you want to view or download a package from.
- To view the custom design, select the custom design name.
- (Optional) To download the custom design package, select the three dots (...) in the Actions column, and then select Download Package.
The custom design package
.zipfolder is downloaded to your OS.
Clone a custom design
You can clone either a draft or published custom design.
- On the Custom Designer page, locate the custom design that you want to clone.
- In the Actions column, select the three dots (...), and then select Clone.
- Update your cloned custom design as needed.
- On the Design Summary page, select Save as Draft or Publish Design.
Only published designs can be used in a planned run or manual run on the instrument.
Delete a custom design
You can delete either a draft or published custom design.
- On the Custom Designer page, locate the custom design that you want to delete.
- In the Actions column, select the three dots (...), and then select Delete.
- When the confirmation message appears, select Delete.