Skip to main content

Create a target cell assignment manifest

Create a target cell assignment manifest for Cell Screening runs with Guide RNA.

Overview​

A target cell assignment manifest is a CSV file that tells the system which spacer (guide RNA) sequences to look for during sequencing. When a run includes at least one target site configured for cell assignment, such as a CRISPR optical pooled screen, the system reads each cell's in situ sequencing data, compares detected sequences against your manifest, and assigns each cell to a dominant spacer.

A target site is the downstream flanking sequence region defined in your Cytos™ custom design. It corresponds to the guide scaffold and is used to inform RT and sequencing primer design. Each target site has a spacer library defined in the target cell assignment manifest that the system sequences and performs automated onboard cell assignment.

Target cell assignment manifest information

Note:

The sequence used in the target cell assignment manifest is the reverse complement of the target sequence expressed as RNA. In the following example, the target sequence is 5'-…CAG-3', so the target cell assignment manifest uses 5'-CTG…-3'.

DISS chemistry strand swaps: the expressed gRNA target 5'-xxxxCAG-3' is reverse transcribed to xxxxGTC, amplified into a polony, and read by the sequencing primer as the reverse complement

The manifest works in conjunction with your Cytos custom workflow design (that includes the Guide RNA module), which defines the RT and sequencing primers used to detect each target. You must complete the custom design process and publish the design before uploading this manifest.

Before you begin​

Before creating your manifest, confirm the following:

  • You have published a Cytos custom workflow design in Custom Designer.
  • You know the target site names from your design. TargetSiteName values in the manifest must match these exactly, including capitalization.
  • You know the spacer sequence length for each target site. All sequences within a target site must be the same length.
  • Your spacer sequences are available in the 5' to 3' orientation as they appear in your guide RNA construct.

Manifest sections​

A target cell assignment manifest file includes the following sections. Each section starts with a bracketed section heading that is followed by a row of column headings. Section and column headings are case-insensitive. All subsequent rows list metadata for the section.

  • Target site settings: Define per-target-site settings, including an optional TargetMask override.
  • Target information: List every spacer sequence the system should recognize, mapped to its target site.

Consult cell assignment logic to understand how the system assigns cells to spacers after the run, including confidence scoring and output metrics.

Start from a template​

  1. Download a template.
  2. Open the template in Excel or a text editor.
  3. Edit the template as desired (for example, modify metadata or add columns).
  4. Save the run manifest as a CSV UTF-8 file.
    • Allowed characters in file name are are letters, numbers, dash, dot, parentheses, and underscore.
    • Do not include spaces in the file name.

Template manifests​

Each template includes example customer targets and the GAPDH and ACTB control targets used for run QC. To run without controls, delete the control rows before you upload the manifest. The control target sequences differ by host species, so select the tab that matches your sample.

Note:

If controls are selected in Custom Designer, the manifest must include the following TargetSiteName values exactly as shown, or Custom Designer returns an error:

  • GAPDH_Control
  • ACTB_Control

For human runs, Element Biosciences provides the control primers with the kit — no additional ordering is required. For mouse runs, you must order the mouse RT and sequencing control primers before your run. For primer sequences, see Cytos RT/Seq Control Primers for mouse cells.

Download a template that matches your target layout. Each includes the human control targets, and applies to AVITI OS v3.4.0 and later:

The control targets included in each template are as follows, with sequences listed 5' to 3':

[TARGET INFORMATION]
TargetSiteName,TargetName,Gene,Sequence
GAPDH_Control,GAPDH_1,GAPDH,GTGAGGAGGGGAGATTCAGT
GAPDH_Control,GAPDH_2,GAPDH,GTTGTCATACTTCTCATGGT
GAPDH_Control,GAPDH_3,GAPDH,GGCGCCCAATACGACCAAAT
GAPDH_Control,GAPDH_4,GAPDH,AATGCCAGCCCCAGCGTCAA
ACTB_Control,ACTB_1,ACTB,ACCTTCACCGTTCCAGTTTT
ACTB_Control,ACTB_2,ACTB,ATCTCAAGTTGGGGGACAAA
ACTB_Control,ACTB_3,ACTB,TTCATTGTGCTGGGTGCCAG
ACTB_Control,ACTB_4,ACTB,GTAGCTCTTCTCCAGGGAGG

Element supplies the human control sequencing primers, so you do not need to order them separately.

Create an original file​

  1. Open a new file in Excel. Or, open an application that can save .csv files.

  2. Enter any of the following section headings and their column headings:

    [TARGET SITE SETTINGS]
    TargetSiteName,SettingName,Value,
    [TARGET INFORMATION]
    TargetSiteName,TargetName,Gene,Sequence

  3. Add metadata to the Target site settings and Target information sections.

  4. Ensure that all spacer sequences under each TargetSiteName are identical in length, and that the length matches the TargetMask configured in your custom design. For more information, see Target information.

  5. Save the target cell assignment manifest as a CSV UTF-8 file.

    • Allowed characters in file name are are letters, numbers, dash, dot, parentheses, and underscore.
    • Do not include spaces in the file name.
Last updated on