Samples

The Samples section includes the SampleName, Index1, Index2, Project, Lane, and ExternalID columns. When the Samples section is populated, only SampleName is required. When unpopulated, Bases2Fastq defaults to an entry that specifies one unindexed sample for each lane.

Columns

Column	Value
SampleName	The name of each library in the run. Each name can include 1–64 case-sensitive alphanumeric characters, hyphens (-), and underscores (_).
Index1, Index2	The Index 1 and Index 2 sequences that correspond to each library. Each sequence consists of A, C, G, and T, with a plus sign separating multiple sequences.
Lane	The number of a lane to restrict a library to: 1, 2, or 1+2 (default). If you are using the individually addressable lanes add-on with two library pools, lane 1 refers to the Library well, and lane 2 refers to the AUX well.
Project	The name of a project to group samples together. Each name can include case-sensitive alphanumeric characters, hyphens (-), and underscores (_). Project names for samples must exactly match to successfully group samples together. Make sure no sample is assigned to more than one project. Bases2Fastq assigns any samples missing a project to a default project named DefaultProject.
ExternalID	An alternative sample name or other external identifier to associate a library with. Each identifier can include 1–64 alphanumeric characters, hyphens, and underscores.

Recording Index Sequences

The index sequences recorded for an experimental library depend on the library prep workflow and --force-index-orientation argument in Bases2Fastq. When the argument is used, Bases2Fastq uses the orientation recorded in the run manifest. By default, Bases2Fastq detects and uses the correct index sequence orientation regardless of the orientation recorded in the run manifest.

Sample to Index Mapping

A repeated sample name links the specified index sequences to each other, so you must consistently capitalize sample names. Single or dual indexes can be specified as follows.

• If you specify multiple indexes for Index 1 and Index 2 in the same row, Bases2Fastq uses all possible pairwise combinations.
• In the SampleName column, enter the name of each library in the run.
• In the Index1 and Index2 columns, enter the index sequences for each library in the same orientation.
  • For unindexed libraries, leave the Index1 and Index2 columns blank.
  • For single-indexed libraries, leave the Index2 column blank.

Index Orientation

When recording sequences in the Index1 and Index2 columns, use the same orientation for each sequence in a column. Entering the wrong sequences or mixing orientations affects index assignment.

• For the Adept Workflow, enter the third-party index sequences.
  • If orientation detection is enabled in Bases2Fastq, enter the third-party index sequences as found in documentation.
  • If orientation detection is disabled in Bases2Fastq, enter the third-party index sequences in the correct orientation. For guidance, see Read Orientation.

Index Sequence Selection

• For the Elevate Workflow, enter the Elevate Cloudbreak™ Index Sequences.
• For the LoopSeq for AVITI, enter the LoopSeq for AVITI Index Sequences.
• If a run includes a PhiX spike-in, enter the applicable sample names and index sequences listed in PhiX Control Library Index Sequences. Each PhiX Control library includes four index pairs with defined names and sequences.

Read Orientation

The Adept Workflow depends on a third-party kit, so an Adept library has P5 and P7 sides. The P5 and P7 sequences are not Element components. In contrast, the Elevate Workflow uses Element indexes and adapters to prepare libraries with SP5 and SP27 sides.

AVITI OS v2.0.0 or later sequences the library and the complementary sequence, including any indexes. Index 1, Index 2, and Read 1 occur in order on the P5 or SP5 side. The run then performs Read 2 on the P7 or SP27 side.

Figure 2: Sequencing Adept and Elevate libraries

Custom Sample-Level Metadata

An optional addition to the Wells section, custom columns specify additional key-value metadata for wells. Custom columns must meet the following requirements:

• Each custom column name is unique, including case-sensitive variations.
• A custom column cannot have the same name as a required column.
• When a sample name is repeated, each corresponding value in the custom column must match exactly.
• The key character limit is 1–64. Valid characters include lower- and upper-case letters, numbers, hyphens, and underscores.
• The value character limit is 0–255 ASCII characters.

Sample Specification Examples

The following examples show how to enter samples for specific use cases.

Using Individually Addressable Lanes with Projects

• Use the Individually Addressable Lanes add-on with two library pools and associate samples with projects Library_Pool_1 or Library_Pool_2.

[Samples],,,
SampleName,Index1,Index2,Lane,Project
Sample_1,CCC,AAA,1,Library_Pool_1
Sample_2,TTT,GGG,1,Library_Pool_1
Sample_3,AAA,GGG,2,Library_Pool_2

Add Custom Sample-Level Metadata

• Add a custom column, Custom_Metadata, with the value of Sample_1_metadata, Sample_2_metadata, and Sample_3_metadata for three distinct sample.

[Samples],,,
SampleName,Index1,Index2,Lane,Custom_Metadata
Sample_1,CCC,,1,Sample_1_metadata
Sample_2,TTT,,1,Sample_2_metadata
Sample_3,AAA,,1,Sample_3_metadata

Defining Index Sequences

• Associate a sample named ID1 with the Index 1 sequences AAAA and TTTT. You can organize the index sequences within a single column and use a plus sign (+) to combine them. You can also list the index sequences in individual sample rows.

[Samples]
SampleName,Index1
ID1,AAAA+TTTT

[Samples]
SampleName,Index1
ID1,AAAA
ID1,TTTT

• Associate a sample named ID1 to a combined Index 1 and Index 2 sequence, AAAATTTT.

[Samples]
SampleName,Index1,Index2
ID1,AAAA,TTTT

• Associate a sample named ID1 to the combined Index 1 and Index 2 sequences AAAATTTT and CCCCGGGG.

[Samples]
SampleName,Index1,Index2
ID1,AAAA,TTTT
ID1,CCCC,GGGG

• Associate a sample named ID1 to the combined Index 1 and Index 2 sequences AAAATTTT, AAAAGGGG, CCCCTTTT, and CCCCGGGG.

[Samples]
SampleName,Index1,Index2
ID1,AAAA+CCCC,TTTT+GGGG

Reconciling Different Index Sequence Lengths

If the index sequences for samples in a run manifest do not have the same length, use one of the following approaches to reconcile the difference:

• Use a single run manifest and append the first nucleotides of the adapter read next in sequencing to the end of shorter index sequences. This addition allows the shorter index sequences to match the length of the longest index sequence.

• Use two run manifests with different index sequence lengths, and execute Bases2Fastq twice. Make sure to update any impacted settings, such as base masks.

The following examples demonstrate these approaches for a scenario with two samples with different index sequence lengths. Sample1 uses 8 bp index sequences and Sample2 uses 10 bp index sequences. The run manifest contains sequences for R1Adapter and R2Adapter, and the sequencing run uses the outer primer 5' AGATCGGAAGAGCACACGTCTGAACTCCAGTCA 3'.

[Settings]
R1Adapter, CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT
R2Adapter, AGTTGACAAGCGGTAGCCTGCACACCTTCCGACAT
[Samples]
SampleName,Index1,Index2
Sample1,AGGCAGAA,TGCTACGA
Sample2,CGTTCTCTTG,CACCAAGTGG

Use a Single Run Manifest

To use a single run manifest for this scenario, revise the run manifest index sequences as follows:

1. Append the first two nucleotides of the outer primer (AG) to the end of the Index1 sequence for Sample1.
2. Append the first two nucleotides of the R1Adapter (CG) to the end of the Index2 sequence for Sample1.

[Settings]
R1Adapter, CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT
R2Adapter, AGTTGACAAGCGGTAGCCTGCACACCTTCCGACAT
[Samples]
SampleName,Index1,Index2
Sample1,AGGCAGAAAG,TGCTACGACG
Sample2,CGTTCTCTTG,CACCAAGTGG

Use Two Run Manifests

The following example run manifests show the same samples and index sequences in two run manifests.

• Run Manifest A contains the 8 bp index sequences for Sample1.
• Run Manifest B contains the 10 bp index sequences for Sample2.

Run Manifest A, Sample 1 (8 bp)

[Settings]
R1Adapter, CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT
R2Adapter, AGTTGACAAGCGGTAGCCTGCACACCTTCCGACAT
I1Mask, I1:Y8N*
I2Mask, I2:Y8N*
[Samples]
SampleName,Index1,Index2
Sample1,AGGCAGAA,TGCTACGA

Run Manifest B, Sample 2 (10 bp)

[Settings]
R1Adapter, CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT
R2Adapter, AGTTGACAAGCGGTAGCCTGCACACCTTCCGACAT
I1Mask, I1:Y10N*
I2Mask, I2:Y10N*
[Samples]
SampleName,Index1,Index2
Sample2,CGTTCTCTTG,CACCAAGTGG