Target information
Define the spacer sequence library used for cell assignment.
Target information defines the complete library of spacer (guide RNA) sequences the system searches during cell assignment. Each row maps a spacer sequence to a target site. During analysis, Cells2Stats compares every detected read against this library to assign which spacer is dominant in each cell.
The sequences listed here must correspond to the guide RNA spacers in your CRISPR library, and their length must match the TargetMask defined in your Custom Designer workflow.
Columns
When the Target information section is populated, TargetSiteName, TargetName, and Sequence are required. Data input in the Target information section must match the information that is provided in the associated Teton Atlas™ custom workflow design.
| Column | Constraints | Definition | Allowed Values |
|---|---|---|---|
TargetSiteName | Required | The name of the target site that is sequenced in the cytoprofiling run and is present in the associated Teton Atlas custom design | 1-64 case-sensitive alphanumeric characters, hyphens (-), and underscores (_) |
TargetName | Required | The unique name of the target that is associated with the target site | 1-64 case-sensitive alphanumeric characters, hyphens (-), and underscores (_) |
Gene | Optional | The gene name that is associated with the target | 1-64 case-sensitive alphanumeric characters, hyphens (-), and underscores (_) |
Sequence | Required | The spacer nucleotide sequence in 5' to 3' orientation, as it appears in the guide RNA construct | DNA sequence (A, T, C, G only) |
ControlType | Optional | Identifies a target as a control type and is used in CytoCanvas™ visualization | NontargetingControl, TargetingControl, or blank |
Critical sequence requirements
All spacer sequences within a target site must be the same length. This is the most common cause of manifest validation failures.
The system cannot process a target site where sequences vary in length, and Custom Designer rejects manifests where sequence lengths do not match the TargetMask.
Incorrect — mixed lengths (will fail):
[TARGET INFORMATION]
TargetSiteName,TargetName,Gene,Sequence
GRNATarget1,sgRNA_001,TP53,AATCGAATCGAATCGAATCG
GRNATarget1,sgRNA_002,BRCA1,TTCGAATCG
GRNATarget1,sgRNA_003,EGFR,CCGTGATATCAGCAGGTAGA
Correct — all 20 bp (will pass):
[TARGET INFORMATION]
TargetSiteName,TargetName,Gene,Sequence
GRNATarget1,sgRNA_001,TP53,AATCGAATCGAATCGAATCG
GRNATarget1,sgRNA_002,BRCA1,TTCGAATCGAATCGAATCGA
GRNATarget1,sgRNA_003,EGFR,CCGTGATATCAGCAGGTAGA
Sequence length must match the TargetMask
The number of bases in each spacer sequence must equal the number of Y cycles in the TargetMask for that target site. For example, a TargetMask of Y20N* requires all sequences to be exactly 20 bases. This is validated when the manifest is attached to a design in Custom Designer.
Sequence orientation
Enter sequences in the 5' to 3' direction, exactly as the spacer appears in the guide RNA construct targeting the gene of interest. Do not enter the reverse complement — the system handles orientation internally based on the sequencing primer design.
Additional notes
- Sequences must contain only A, T, C, and G. Ambiguous bases (N), spaces, and modified bases are not permitted.
TargetNamevalues must be unique within each target site.- If you have multiple target sites, sequences under different
TargetSiteNamevalues do not need to share the same length — the uniformity requirement applies independently within each target site.
Custom target-level metadata
Custom columns are optional and can be added to the Target information section to specify additional key-value metadata per spacer. This metadata is carried through to downstream analysis output files. Custom columns must meet the following requirements:
- Each custom column name is unique and includes case-sensitive variations.
- A custom column cannot have the same name as a required column.
- When a target name is repeated, each corresponding value in the custom column must match exactly.
- The key character limit is 1–64. Valid characters include lowercase and uppercase letters, numbers, hyphens (-), and underscores (_).
- The value character limit is 0–255 ASCII characters.
Target specification examples
The following examples show how to construct a manifest for specific use cases.
Single target site — basic CRISPR screen
A minimal manifest for a screen using 20 bp spacers with non-targeting controls:
[TARGET INFORMATION]
TargetSiteName,TargetName,Gene,Sequence,ControlType
GRNATarget1,sgRNA_TP53-001,TP53,CCGTGATATCAGCAGGTAGA,
GRNATarget1,sgRNA_BRCA1-001,BRCA1,GAAGCAATACCTCATTAAAC,
GRNATarget1,NT-ctrl-001,NonTargeting,TTCGACTCACGCGCTTACCA,NontargetingControl
All three sequences above are 20 bp. With TargetMask Y20N*, this manifest passes validation.
Multiple target sites
Each target site has its own rows. Sequences within each site must be uniform in length, but different sites can use different lengths:
[TARGET INFORMATION]
TargetSiteName,TargetName,Gene,Sequence,ControlType
Site1_gRNA,sgRNA_TP53-001,TP53,CCGTGATATCAGCAGGTAGA,
Site1_gRNA,NT-ctrl-001,NonTargeting,GAAGCAATACCTCATTAAAC,NontargetingControl
Site2_gRNA,sgRNA_EGFR-001,EGFR,TTCGACTCACGCGCTTACCGA,
Site2_gRNA,sgRNA_EGFR-002,EGFR,GGTGCCGCATGACGAGCCAAT,
With custom metadata
Add custom columns to carry experimental metadata (perturbation name, plate, and similar) through to output files:
[TARGET INFORMATION]
TargetSiteName,TargetName,Gene,Sequence,PerturbationName,LibraryPlate
GRNATarget1,sgRNA_TP53-001,TP53,AATCGAATCGAATCGAATCG,TP53-KO,Plate1
GRNATarget1,sgRNA_BRCA1-001,BRCA1,CCGTGATATCAGCAGGTAGA,BRCA1-KO,Plate1
GRNATarget1,NT-ctrl-001,NonTargeting,GAAGCAATACCTCATTAAAC,,Plate1