Skip to main content

Create an MPS custom design

Build and publish a Cytos™ Multimodal Pooled Screening design in Custom Designer.

Create the design​

  1. On the Custom Designer page, select Start a Design.
  2. Enter a unique name and, optionally, a description.
  3. Under Configure your Cytos Workflow, toggle RNA to add RNA detection, and then select both Guide RNA and 3' Transcriptome.
  4. If including protein, toggle Protein on to add protein detection.
  5. Select Customize Modules to begin your design.
  6. Review the cell paint module, and then select Next.
  7. If you added protein detection, build your protein panel. See Build a protein panel.
  8. Configure the Guide RNA batch, and then provide your guide RNA library inputs. See Customize an RNA sequencing batch.
    • Guide RNA: Use for optical pooled screens, spacers, barcodes, and similar.
    • Advanced Targets: Use for advanced applications that require custom primers such as sequencing viral transcripts or gene fusions.
  9. Review the 3' Transcriptome batch settings. Custom Designer determines the batches and cycles per batch automatically.
  10. Select Finalize Design, and review the design package summary.
  11. Select Save as Draft, or on the Design Package Preview page, select Publish Design.

    Only published designs can be used in a planned run or manual run on the instrument.

Build a protein panel​

A design that includes protein detection captures protein expression alongside the other modalities in the design. Build the panel from Cytos Fixed Protein Panels, your own custom targets, or both, up to a maximum of 20 protein targets.

  1. Select the protein module.
  2. Add targets from either source, or from both:
    • Cytos Fixed Protein Panels: Select any combination of panels. Each panel consumes four of your 20 total targets. See the Cytos Protein Panel Targets (MA-00099) for the protein targets in each panel.
    • Custom Protein Targets: Enter names manually with one protein per line, paste from Excel, or upload a CSV file. For custom protein naming rules and example inputs, see Format custom protein targets.
  3. Select Next.
Note:

You are responsible for providing the primary antibodies for custom proteins.

Caution:

Fluorescent reporter cell lines are not recommended. Fluorescent reporters can interfere with Cytos imaging and might reduce image quality or affect downstream results. Element does not recommend or support workflows that use fluorescent reporter cell lines.

Format custom protein targets​

Custom protein targets that are part of custom designs must meet the following specifications:

  • Protein names can include up to 64 letters (A-Z, a-z), numbers (0-9), dash, dot, parentheses, and underscores. Do not include spaces.
  • For manual entry, separate protein names with a new line, paste from Excel, or upload the protein names in a CSV file format.

The following names are examples of custom protein targets:

phos-ATM
Plk1
phosS32-cFos
phosS78-HSP27
Rb
cFOS
JNK123

Customize an RNA sequencing batch​

DISS chemistry on Cytos is supported by single‑sided probe chemistry for cDNA extension, circularization, and rolling‑circle amplification, which is followed by sequencing that uses Avidite™ base chemistry (ABC™). A dual-primer design is used to improve specificity for guide RNA sequencing.

Direct In Sample Sequencing

Direct In Sample Sequencing workflow: probe hybridization, cDNA extension, circularization, rolling circle amplification, and sequencing by ABC

In this scheme, a reverse transcription (RT) primer binds to the 3′ flanking region of the target RNA sequence (for example, downstream of the target region, and toward the 3′ end of the RNA). Reverse transcription proceeds toward the 5' end of the RNA, and synthesizes cDNA that contains the intended target sequence. After cDNA circularization and rolling circle amplification completes, a sequencing primer binds upstream of the target. Sequencing immediately starts at the end of the sequencing primer and proceeds in the 3' to 5' direction relative to the parent RNA. This orientation ensures that the RT primer and the sequencing primer bind successfully at opposite ends of the target. This dual-binding requirement increases specificity and helps prevent off-target reads.

Guide-based primer scheme

Guide-based primer scheme showing the RT primer binding downstream of the target and the sequencing primer binding upstream

Based on your needs, select one of the following RNA applications:

  • Guide RNA Sequencing Applications: ElemBio Cloud designs the RT and sequencing primer for you.
    • Input 80-100 base pairs of the target's downstream sequence and Custom Designer generates complementary RT and sequencing primers for your target of interest.
    • Order primers from any third-party oligo provider.
    • Complete target-to-cell assignment for optical pooled screens that use spacers, barcodes, or similar where perturbations are assigned to cells.
  • Advanced Non-Guide RNA Sequencing Applications: Design your own primers for advanced applications such as sequencing viral transcripts, gene fusions, and more.
    • When designed, you can upload sequences as part of your custom design.
    • For more information on criteria and support for custom primer designs, see Custom primer design for Cytos.
Caution:

When you use Custom Designer for non-guide RNA sequencing applications, you assume the risk of run failures and detrimental run performance. For more information on optimization of primers for non-guide RNA applications, contact Element Technical Support to discuss your use case.

Set up guide RNA sequencing applications​

For guide RNA sequencing applications, you can define up to 5 target sites. The settings you configure here — particularly Target Site Name, Cycle Length, and TargetMask — must align with the spacer sequences you provide in your target cell assignment manifest. For each target site, complete the following fields:

  1. Select the Guide RNA Module, and then select Guide RNA.

  2. In the Cycle Length field, enter 4-50 sequencing cycles.

    Set the cycle length equal to or greater than your spacer sequence length. For example, if your spacers are 20 bp, enter 20.

  3. Select the type of controls.

    Cytos Guide RNA Human Controls target GAPDH and ACTB. Controls are strongly recommended for Guide RNA sequencing. Without them, troubleshooting and result interpretation may be limited.

  4. Enter a unique name for the target site.

    This name must match the TargetSiteName values in your target cell assignment manifest exactly, including capitalization. A mismatch causes the manifest to fail validation.

  5. In the Downstream Flanking Sequence field, use bases A, T, C, and G to enter 80-100 base pairs from the region downstream of your target site.

    Enter this sequence in the 5' to 3' direction. This is the 100 bp immediately downstream of your guide RNA spacer region on the sense strand of your construct. Custom Designer uses this sequence to generate RT and sequencing primer designs.

  6. In the Perform Target Cell Assignment field, select Yes or No based on the following:

    • Yes: Onboard target to cell assignment occurs and additional output files are generated. Also, selecting Yes requires a target cell assignment manifest during run setup. Select Yes for spacers, barcodes, or similar.
    • No: Onboard target to cell assignment does not occur.

  7. If you selected Yes to perform target cell assignment, enter a basemask in the TargetMask field that defines the cycles in which your target is present. TargetMask length cannot exceed 50 base pairs.

    This value is validated against all target cell assignment manifests that are attached to the design, and must match the sequence length of target sequences that are defined in the target.

    How to set your TargetMask:

    • Use Y followed by a number to include cycles (e.g., Y20) and N* to skip remaining cycles.
    • For a 20 bp spacer starting at cycle 1, enter Y20N*.
    • For a 23 bp spacer starting at cycle 1, enter Y23N*.
    • The number of Y cycles must equal the length of spacer sequences in your manifest.

    For the full base mask specification, see Base masks.

  8. In the Set up target cell manifests section, if you have selected Yes to perform target cell assignment, then set up target cell assignment manifests. For more information, see Prepare a target cell assignment manifest. For guidance on how the system uses the manifest to assign cells to spacers after the run, see Cell assignment logic.

  9. (Optional) To add another target site, select Add Another Target Site and repeat steps 1-7. You can add up to 5 target sites.

About the TargetMask and your manifest

The TargetMask you enter here is stored in the design's panel.json. When you upload a target cell assignment manifest to this design, the manifest is validated against this mask — spacer sequence lengths must match the number of Y cycles. If they do not match, the manifest upload fails. You can also override the TargetMask per-manifest using the [TARGET SITE SETTINGS] section. For more information, see Target site settings.

Set up advanced non-guide RNA sequencing applications​

  1. Select the Guide RNA Module, and then select Advanced Targets.

  2. In the Cycle Length field, enter 4-50 cycles for advanced applications.

  3. Select the checkbox to acknowledge risks.

  4. Upload a csv file of your custom primers. For more information on criteria and support for custom primer designs, see Custom primer design for Cytos. The following is an example .csv format:

    TargetSiteName, TargetMask, RTOligo, SequencingPrimer
    1_FirstTarget,Y20N*, GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTAAGCTTGGCGTAACTAGA, ATTTTAACTTGCTATTTCTAGCTCTAAAAC
    2_SecondTarget,Y20N*,GTTTCAGAGCTAAGCACAAGAGTGCATAGCAAGTTGAAATAAGGCTAGTCCGTTTACAACTTGAAAAAGTGGCACCCGAGTCGGGTGC,CACTTTTTCAAGTTGTAAACGGACTAGCCT

Order custom primers for RNA sequencing​

After you publish a design that includes a guide RNA batch, download the design package to get the primer sequences that Custom Designer generated.

  1. On the Custom Designer page, locate the published custom design that you want to order primers from.
  2. Select the three dots (...) under the Actions column, and then select Download Package.
  3. Locate the downloaded package in your OS.
  4. Unzip the downloaded package, and then identify the primer-sequences.csv file.
  5. The primer-sequences.csv file provides sequences for you to order through any oligo manufacturer. When ordering, ensure the RT Oligo contains a 5' phosphate and is HPLC purified. The Seq Oligo can be desalted.

Manage your design​

To edit, clone, download, or delete a design after you create it, see Custom Designer.

See also​

Last updated on